Skip to content
Snippets Groups Projects
Commit 7e3489c4 authored by Joan Hérisson's avatar Joan Hérisson
Browse files

refactor

parent cc23c2e4
No related branches found
No related tags found
No related merge requests found
Show whitespace changes
Inline Side-by-side
RotTable.py → 3dna/RotTable.py
+ 38
− 0
View file @ 7e3489c4
import mathutils
import math
from copy import deepcopy
from json import load as json_load
from os import path as os_path
here = os_path.abspath(os_path.dirname(__file__))
class RotTable:
"""Represents the rotation table"""
# 3 first values: 3 angle values
# 3 last values: SD values
__ORIGINAL_ROT_TABLE = {\
"AA": [35.62 , 7.2 , -154 , 0.06 , 0.6 , 0],\
"AC": [34.4 , 1.1 , 143 , 1.3 , 5 , 0],\
"AG": [27.7 , 8.4 , 2 , 1.5 , 3 , 0],\
"AT": [31.5 , 2.6 , 0 , 1.1 , 2 , 0],\
"CA": [34.5 , 3.5 , -64 , 0.9 , 34 , 0],\
"CC": [33.67 , 2.1 , -57 , 0.07 , 2.1 , 0],\
"CG": [29.8 , 6.7 , 0 , 1.1 , 1.5 , 0],\
"CT": [27.7 , 8.4 , -2 , 1.5 , 3 , 0],\
"GA": [36.9 , 5.3 , 120 , 0.9 , 6 , 0],\
"GC": [40 , 5 , 180 , 1.2 , 1.275 , 0],\
"GG": [33.67 , 2.1 , 57 , 0.07 , 2.1 , 0],\
"GT": [34.4 , 1.1 , -143 , 1.3 , 5 , 0],\
"TA": [36 , 0.9 , 0 , 1.1 , 2 , 0],\
"TC": [36.9 , 5.3 , -120 , 0.9 , 6 , 0],\
"TG": [34.5 , 3.5 , 64 , 0.9 , 34 , 0],\
"TT": [35.62 , 7.2 , 154 , 0.06 , 0.6 , 0]\
}
__ORIGINAL_ROT_TABLE = json_load(
open(os_path.join(here, 'table.json'))
)
def __init__(self):
self.__Rot_Table = {}
for dinucleotide in RotTable.__ORIGINAL_ROT_TABLE:
self.__Rot_Table[dinucleotide] = RotTable.__ORIGINAL_ROT_TABLE[dinucleotide][:3]
self.__Rot_Table = deepcopy(RotTable.__ORIGINAL_ROT_TABLE)
###################
......
Traj3D.py → 3dna/Traj3D.py
+ 30
− 22
View file @ 7e3489c4
#For computing
import mathutils
from mathutils import (
Matrix,
Vector
)
import math
#For drawing
import numpy as np
import matplotlib.pyplot as plt
from mpl_toolkits.mplot3d import Axes3D
from matplotlib import collections as mc
class Traj3D:
"""Represents a 3D trajectory"""
# Vertical translation (elevation) between two di-nucleotides
__MATRIX_T = mathutils.Matrix.Translation((0.0, 0.0, 3.38/2.0, 1.0))
__MATRIX_T = Matrix.Translation((0.0, 0.0, 3.38/2.0, 1.0))
def __init__(self):
self.__Traj3D = {}
self.fig = plt.figure()
self.ax = self.fig.add_subplot(111, projection='3d')
def getTraj(self):
return self.__Traj3D
......@@ -24,10 +27,10 @@ class Traj3D:
def compute(self, dna_seq, rot_table):
# Matrice cumulant l'ensemble des transformations géométriques engendrées par la séquence d'ADN
total_matrix = mathutils.Matrix()
total_matrix = Matrix()
# On enregistre la position du premier nucléotide
self.__Traj3D = [mathutils.Vector((0.0, 0.0, 0.0, 1.0))]
self.__Traj3D = [Vector((0.0, 0.0, 0.0, 1.0))]
matrices_Rz = {}
matrices_Q = {}
......@@ -37,31 +40,36 @@ class Traj3D:
dinucleotide = dna_seq[i-1]+dna_seq[i]
# On remplit au fur et à mesure les matrices de rotation
if dinucleotide not in matrices_Rz:
matrices_Rz[dinucleotide] = mathutils.Matrix.Rotation(math.radians(rot_table.getTwist(dinucleotide)/2), 4, 'Z')
matrices_Rz[dinucleotide] = Matrix.Rotation(
math.radians(rot_table.getTwist(dinucleotide)/2), 4, 'Z'
)
matrices_Q[dinucleotide] = \
mathutils.Matrix.Rotation(math.radians((rot_table.getDirection(dinucleotide)-90)), 4, 'Z') \
@ mathutils.Matrix.Rotation(math.radians((-rot_table.getWedge(dinucleotide))), 4, 'X') \
@ mathutils.Matrix.Rotation(math.radians((90-rot_table.getDirection(dinucleotide))), 4, 'Z')
Matrix.Rotation(
math.radians((rot_table.getDirection(dinucleotide)-90)), 4, 'Z'
) \
@ Matrix.Rotation(
math.radians((-rot_table.getWedge(dinucleotide))), 4, 'X'
) \
@ Matrix.Rotation(
math.radians((90-rot_table.getDirection(dinucleotide))), 4, 'Z'
)
# On calcule les transformations géométrique selon le dinucleotide courant, et on les ajoute à la matrice totale
total_matrix = total_matrix @ \
# On calcule les transformations géométriques selon le dinucleotide courant, et on les ajoute à la matrice totale
total_matrix @= \
self.__MATRIX_T \
@ matrices_Rz[dinucleotide] \
@ matrices_Q[dinucleotide] \
@ matrices_Rz[dinucleotide] @ \
self.__MATRIX_T
@ matrices_Rz[dinucleotide] \
@ self.__MATRIX_T
# On calcule la position du nucléotide courant en appliquant toutes les transformations géométriques à la position du premier nucléotide
self.__Traj3D.append(total_matrix @ self.__Traj3D[0])
def draw(self, filename):
def draw(self):
xyz = np.array(self.__Traj3D)
self.__Traj3D = []
x, y, z = xyz[:,0], xyz[:,1], xyz[:,2]
fig = plt.figure()
ax = fig.add_subplot(111, projection='3d')
ax.plot(x,y,z)
self.ax.plot(x,y,z)
plt.show()
plt.savefig(filename)
def write(self, filename):
self.fig.savefig(filename)
\ No newline at end of file
3dna/__main__.py 0 → 100644
+ 28
− 0
View file @ 7e3489c4
from .RotTable import RotTable
from .Traj3D import Traj3D
import argparse
parser = argparse.ArgumentParser()
parser.add_argument("filename", help="input filename of DNA sequence")
parser.parse_args()
args = parser.parse_args()
def main():
rot_table = RotTable()
traj = Traj3D()
# Read file
lineList = [line.rstrip('\n') for line in open(args.filename)]
# Formatting
seq = ''.join(lineList[1:])
traj.compute(seq, rot_table)
print(traj.getTraj())
traj.draw()
traj.write(args.filename+".png")
if __name__ == "__main__" :
main()
3dna/table.json 0 → 100644
+ 18
− 0
View file @ 7e3489c4
{
"AA": [35.62 , 7.2 , -154 , 0.06 , 0.6 , 0],
"AC": [34.4 , 1.1 , 143 , 1.3 , 5 , 0],
"AG": [27.7 , 8.4 , 2 , 1.5 , 3 , 0],
"AT": [31.5 , 2.6 , 0 , 1.1 , 2 , 0],
"CA": [34.5 , 3.5 , -64 , 0.9 , 34 , 0],
"CC": [33.67 , 2.1 , -57 , 0.07 , 2.1 , 0],
"CG": [29.8 , 6.7 , 0 , 1.1 , 1.5 , 0],
"CT": [27.7 , 8.4 , -2 , 1.5 , 3 , 0],
"GA": [36.9 , 5.3 , 120 , 0.9 , 6 , 0],
"GC": [40 , 5 , 180 , 1.2 , 1.275 , 0],
"GG": [33.67 , 2.1 , 57 , 0.07 , 2.1 , 0],
"GT": [34.4 , 1.1 , -143 , 1.3 , 5 , 0],
"TA": [36 , 0.9 , 0 , 1.1 , 2 , 0],
"TC": [36.9 , 5.3 , -120 , 0.9 , 6 , 0],
"TG": [34.5 , 3.5 , 64 , 0.9 , 34 , 0],
"TT": [35.62 , 7.2 , 154 , 0.06 , 0.6 , 0]
}
\ No newline at end of file
INSTALL.md
+ 3
− 3
View file @ 7e3489c4
......@@ -3,7 +3,7 @@
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://www.nicepng.com/png/full/506-5068487_open-install-png-logo.png" alt="Install" height="20"/> `docker build -t 3dna .`
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://icon-library.com/images/play-icon-white-png/play-icon-white-png-26.jpg" alt="Run" height="20"/> `docker run --rm -v $PWD:$PWD -w $PWD 3dna python Main.py`
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://icon-library.com/images/play-icon-white-png/play-icon-white-png-26.jpg" alt="Run" height="20"/> `docker run --rm -v $PWD:$PWD -w $PWD 3dna python -m 3dna data/plasmid_8k.fasta`
<br/>
<br/>
......@@ -15,10 +15,10 @@
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Then,
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://icon-library.com/images/play-icon-white-png/play-icon-white-png-26.jpg" alt="Run" height="20"/> `conda run -n 3dna python Main.py`
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://icon-library.com/images/play-icon-white-png/play-icon-white-png-26.jpg" alt="Run" height="20"/> `conda run -n 3dna python -m 3dna data/plasmid_8k.fasta`
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;or
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://icon-library.com/images/play-icon-white-png/play-icon-white-png-26.jpg" alt="Run" height="20"/> `conda activate 3dna`
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://icon-library.com/images/play-icon-white-png/play-icon-white-png-26.jpg" alt="Run" height="20"/> `python Main.py`
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://icon-library.com/images/play-icon-white-png/play-icon-white-png-26.jpg" alt="Run" height="20"/> `python -m 3dna data/plasmid_8k.fasta`
Main.py deleted 100644 → 0
+ 0
− 33
View file @ cc23c2e4
from RotTable import *
from Traj3D import *
import argparse
parser = argparse.ArgumentParser()
parser.add_argument("--filename", help="input filename of DNA sequence")
parser.parse_args()
args = parser.parse_args()
def main():
rot_table = RotTable()
traj = Traj3D()
if args.filename:
# Read file
lineList = [line.rstrip('\n') for line in open(args.filename)]
# Formatting
seq = ''.join(lineList[1:])
traj.compute(seq, rot_table)
else:
traj.compute("AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCCAGTAAACGAAAAAACCGCCTGGGGAGGCGGTTTAGTCGAAGGTTAAGTCAG", rot_table)
print(traj.getTraj())
if args.filename:
traj.draw(args.filename+".png")
else:
traj.draw("sample.png")
if __name__ == "__main__" :
main()
plasmid_180k.fasta → data/plasmid_180k.fasta
+ 0
− 0
View file @ 7e3489c4
File moved
plasmid_8k.fasta → data/plasmid_8k.fasta
+ 0
− 0
View file @ 7e3489c4
File moved
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Please register or to comment